BglI from New England Biolabs

Product Specs
ItemBglI
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberR0143S
Concentration10 u/µL
Quantity2000 units
ApplicationsDNA Manipulation
Brand/TrademarkNew England Biolabs Inc (NEB)
TypeRestriction Enzyme
Temperature-20 C

Sequence

GCCN4/NGGC

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) RdJ detection tests to identify a unique MRSA clone of ST105-SCCmecII lineage and its variants disseminated in the metropolitan region of Rio de JaneiroFrontiers in MicrobiologyNovember 20, 2023Matheus Assis Côrtes Esteves, Alice Slotfeldt Viana, Gabriela Nogueira Viçosa, Ana Maria Nunes Botelho, Ahmed M. Moustafa, Felipe Raposo Passos Mansoldo, Adriana Lucia Pires Ferreira, Alane Beatriz Vermelho, Bernadete Teixeira Ferreira-Carvalho, Paul Joseph Planet, et al.product was treated with 10 U of BglI and the reaction performed as recommended by the manufacturer (Cat# R0143L; New England Biolabs, Ipswich, MA, United States). After incubation at 37°C/1 h, 1 μL of 6 X Gel Loading

(2) Several cell-intrinsic effectors drive type I interferon-mediated restriction of HIV-1 in primary CD4 + T cellsbioRxivFebruary 12, 2023Hannah L. Itell, Daryl Humes, Julie OverbaughPBS, and subjected to genomic DNA isolation (QIAGEN #51104). Genomic DNA was digested with BglI (NEB #R0143L) and diluted 1:3 for droplet digital PCR (ddPCR) amplification to measure vector copies per cell. Per

(3) The rapid and highly parallel identification of antibodies with defined biological activities by SLISYNature communicationsJanuary 3, 2023Lu S, Mattox AK, Aitana Azurmendi P, Christodoulou I, Wright KM, Popoli M, Chen Z, Sur S, Li Y, Bonifant CL, et al.µM in TE Buffer. The pADL-10b phagemid vector was digested using BglI enzyme (New England Biolabs, R0143S) with Antarctic Phosphatase (New England Biolabs, M0289L) in manufacturer recommended Buffer 3.1 for

(4) Protocol for high-throughput reservoir quantification across global HIV subtypes using a cross-subtype intact proviral DNA assaySTAR ProtocolsDecember 1, 2022Carolyn S. Fish, Noah A.J. Cassidy, Claire N. Levy, Sean M. Hughes, Keith R. Jerome, Julie Overbaugh, Florian Hladik, Dara A. Lehman,New England Biolabs,Cat# R0117S ddPCR Supermix for probes (no dUTP),Bio-Rad,Cat# 1863024 BgII,New England Biolabs,Cat# R0143S ,, Experimental models: Cell lines,Experimental models: Cell lines,Experimental models: Cell lines ,, J-Lat

(5) HIV reservoir quantification using cross-subtype multiplex ddPCRiScienceJanuary 21, 2022Noah A.J. Cassidy, Carolyn S. Fish, Claire N. Levy, Pavitra Roychoudhury, Daniel B. Reeves, Sean M. Hughes, Joshua T. Schiffer, Sarah Benki-Nugent, Grace John-Stewart, Dalton Wamalwa, et al.R0117S ddPCR supermix for probes (no dUTP),Bio-Rad,"Cat# 1,863,024" BgII,New England BioLabs,Cat# R0143S ,, Experimental models: Cell lines,Experimental models: Cell lines,Experimental models: Cell lines ,, J-lat

(6) HIV reservoir quantification by five-target multiplex droplet digital PCRSTAR ProtocolsDecember 17, 2021Claire N. Levy, Sean M. Hughes, Pavitra Roychoudhury, Chelsea Amstuz, Haiying Zhu, Meei-Li Huang, Dara A. Lehman, Keith R. Jerome, Florian Hladikmin hands-on, 19 h incubation In this step, the restriction enzyme BglI (New England Biolabs, Cat# R0143S) is used to digest the high molecular weight nucleic acid isolated in the previous step. This enzyme

(7) Cavin4 interacts with Bin1 to promote T-tubule formation and stability in developing skeletal muscleJournal of Cell BiologyDecember 6, 2021Harriet P. Lo et al.Sanger sequencing (Australian Genome Research Facility, Brisbane) or restriction digest with BglI (#R0143S; NEB). TILLING (targeting induced local lesions in genomes) mutagenesis screen for identification of

(8) A highly multiplexed droplet digital PCR assay to measure the intact HIV-1 proviral reservoirCell Reports MedicineApril 20, 2021Claire N. Levy et al.,New England BioLabs,Cat#R0560S HindIII,New England BioLabs,Cat#R0104S ScaI,New England BioLabs,Cat#R3122S BglI,New England BioLabs,Cat#R0143S "Proteinase K, 20mg/mL, > 318mAu/mL at 30°C",QIAGEN,Cat#19131 AatII,New England BioLabs,Cat#R0117S Pen

(9) Bi-allelic MCM10 variants associated with immune dysfunction and cardiomyopathy cause telomere shorteningNature communicationsMarch 12, 2021Baxley RM, Leung W, Schmit MM, Matson JP, Yin L, Oram MK, Wang L, Taylor J, Hedberg J, Rogers CB, et al.R0622); CDC45 exon 3, PflMI (NEB R0509), XcmI (NEB R0533) or AlwNI (NEB R0514); MCM4 exon 2, BglI (NEB R0143). To generate HCT116 MUS81-/- exon 2 mutant cell lines, each parental line was transfected with 1 µL

(10) Arsenic Metabolism in Mice Carrying a BORCS7/AS3MT Locus Humanized by Syntenic ReplacementEnvironmental Health PerspectivesAugust 12, 2020Beverly H. Koller, John N. Snouwaert, Christelle Douillet, Leigh A. Jania, Hisham El-Masri, David J. Thomas, Miroslav Stýblodescribed above, and the Black-Red and Purple homology arm PCRs were digested with BglI (NEB; Cat. no. R0143S) and then column purified as described above. The loxP-flanked neomycin resistance gene was ligated

(11) Delta glutamate receptor conductance drives excitation of mouse dorsal raphe neuronseLifeApril 1, 2020Gantz SC, Moussawi K, Hake HS.Addgene 131682",Lot# AAV746 "Chemical compound, drug",Bgl I restriction enzyme,New England Biolabs,Cat# R0143S,- "Chemical compound, drug",D-serine,Millipore Sigma,Cat# S4250,10 mM "Chemical compound, drug",GDPβS-Li3,Millipore Sigma

(12) High-resolution and high-accuracy topographic and transcriptional maps of the nucleosome barriereLifeJuly 31, 2019Zhijie Chen, Ronen Gabizon, Aidan I Brown, Antony Lee, Aixin Song, César Díaz-Celis, Craig D Kaplan, Elena F Koslover, Tingting Yao, Carlos Bustamantekit,DraIII-HF,NEB,Cat# R3510S, Commercial assay or kit,BsaI-HF,NEB,Cat# R3535L, Commercial assay or kit,BglI,NEB,Cat# R0143S, Commercial assay or kit,EagI-HF,NEB,Cat# R3505S, Commercial assay or kit,SapI,NEB,Cat# R0569S, Sequence-based

(13) YAP Partially Reprograms Chromatin Accessibility to Directly Induce Adult Cardiogenesis In VivoDevelopmental cellMarch 25, 2019Monroe TO, Hill MC, Morikawa Y, Leach JP, Heallen T, Cao S, Krijger PHL, de Laat W, Wehrens XHT, Rodney GG, et al.A,Sigma-Aldrich,Cat#10103586001 Blebbistatin,Sigma-Aldrich,Cat#B0560 di-4-ANEPS,Invitrogen,Cat#D-1199 BglII,NEB,Cat#R0143S EcoRI-HF®,NEB,Cat#R3101 BsrGI-HF®,NEB,Cat#R3575L T4 DNA ligase (3C),NEB,Cat#R3575L Proteinase K,Sigma-Aldrich,Cat#P2308-25MG RNAse

(14) mitoTev-TALE: a monomeric DNA editing enzyme to reduce mutant mitochondrial DNA levelsEMBO molecular medicineSeptember 1, 2018Pereira CV, Bacman SR, Arguello T, Zekonyte U, Williams SL, Edgell DR, Moraes CT.R‐GTAGTATTTTAGTTTGGGGCATTTCACTGTAAAGCCGTGTTGG (Hashimoto et al, 2015). Therefore, PCR products were digested with BglI (R0143S, New England Biolabs) in NEBuffer 3.1 (B7203S, New England Biolabs), for 4 h at 37°C (Hashimoto et al,

(15) Short-Term Fasting Reveals Amino Acid Metabolism as a Major Sex-Discriminating Factor in the LiverCell MetabolismAugust 7, 2018Sara Della Torre, Nico Mitro, Clara Meda, Federica Lolli, Silvia Pedretti, Matteo Barcella, Luisa Ottobrini, Daniel Metzger, Donatella Caruso, Adriana MaggiUNG,ThermoFisher/Life Technologies,4324018 PshAI restriction enzyme,NEB,R0593 BglI restriction enzyme,NEB,R0143 G 418 disulfate salt,Sigma Aldrich,A1720 ,, Critical Commercial Assays,Critical Commercial Assays,Critical

(16) Analysis of DNA methylation acquisition at the imprinted Dlk1 locus reveals asymmetry at CpG dyadsEpigenetics & ChromatinDecember 1, 2014Alyssa Gagne, Abigail Hochman, Mahvish Qureshi, Celia Tong, Jessica Arbon, Kayla McDaniel, Tamara L Davisprior to bisulfite mutagenesis as follows: 0.5 μg of genomic DNA was digested with 1 μL BglI (NEB, cat# R0143S) and ligated to 1 μg of a phosphorylated hairpin linker (5′-AGCGATGCGTTCGAGCATCGCTCCC-3′) [35]. A total

Be the First to Write a Review!

BglI

BglI from New England Biolabs

Sequence

New England Biolabs

Citations (16)

Reviews

BglI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map